Processing math: 100%
Sequence (5’ to 3’) ϵ260nm (M1cm1) DOI
AAAGGGTTAGGGTTAGGGTTAGGGAA 278200 10.1093/nar/gkm009

       

Structure diagram of 2HY9

Structure diagram of 2HY9

     

Circular dichroism spectra of the 2HY9 oligonucleotide (10 µM), acquired at 25°C in 0.4-cm path-length cuvettes

Circular dichroism spectra of the 2HY9 oligonucleotide (10 µM), acquired at 25°C in 0.4-cm path-length cuvettes

 

$^{1}$H-NMR spectrum of the 2HY9 oligonucleotide, acquired at 25°C in 100 mM TMAA (pH 7.0) + 1 mM KCl

1H-NMR spectrum of the 2HY9 oligonucleotide, acquired at 25°C in 100 mM TMAA (pH 7.0) + 1 mM KCl

 

Folded fraction of the 2HY9 oligonucleotide as a function of temperature, determined by UV-melting ($\lambda$ = 295 nm)

Folded fraction of the 2HY9 oligonucleotide as a function of temperature, determined by UV-melting (λ = 295 nm)

Native ESI-MS spectra of the 2HY9 oligonucleotide (10 µM)

Native ESI-MS spectra of the 2HY9 oligonucleotide (10 µM)

 

Native ESI-MS spectra of the 2HY9 oligonucleotide (10 µM), focused on the 5$^{-}$ charge state

Native ESI-MS spectra of the 2HY9 oligonucleotide (10 µM), focused on the 5 charge state